| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-03-19 23:05:04 |
| Analysis completed | 2025-03-19 23:05:04 |
| Wall time | 0:0:0 hours |
| locus | COI |
| preliminary_id | Aphididae |
| taxa_of_interest |
Myzus persicae Aphididae |
| country | Ecuador |
| host | Cut flower Rosa |
| sample_id | VE24-1075_COI |
| Query DNA sequence |
>VE24-1075_COI TGGATCATCTCTTAGAATTTTAATTCGATTAGAATTAAGACAAATTAATTCTATTATTWA TAATAATCAATTATATAATGTAATTGTTCACAATTCATGCTTTTATTATAATTTTTTTTA TAACTATACCAATTGTAATTGGTGGATTTGGAAATTGATTAATTCCTATAATAATAGGAT GTCCTGATATATCATTTCCACSTTTAAATAATATTAGATTTTGATTATTACCTCCATCAT TAATAATAATAATTTGTAGATTTTTAATTAATAATGGAACAGGAACAGGATGAACAATTT AYCCHCCTTTATCAAACAATATTGCACATAATAACATTTCAGTTGATTTAACTATTTTTT CTTTACATTTAGCAGGWATCTCATCAATTTTAGGAGCAATTAACTTTATTTGTACAATTC TTAATATAATAYCAAAYAATATAAAACTAAATCAAATTCCTCTTTTTCCTTGATCAATTT TAATTACAGCTATTTTATTAATTTTATMTTTACCAGTTTTAGCTGGTGCCATTACAATAT TATTAACTGATCGTAATTTAAATACATCATTTTTGATCCAGCAGGAGGAGGAGATCC
Inconclusive
The analyst should attempt subjective species identification at the genus level.
Reasoning - Flag 1D:
At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%).
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1D) |
|
| Taxa of interest ruled out | False |
|
Flag 2B: Taxon of interest detected Flag 5.1NA: Assessment of related species is only possible for taxa at rank genus/species Flag 5.2NA: Assessment of related species is only possible for taxa at rank genus/species |
|
Flag 1D:
The analyst should attempt subjective species identification at the genus level
At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 0 | 0 |
| MODERATE MATCH | ≥ 93.5% | 500 | 101 |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|---|---|---|
| Macrosiphum sp. BOLD-2016 | 181 | 98.1% | 0.0 |
| Macrosiphum euphorbiae | 78 | 97.8% | 0.0 |
| Macrosiphum cholodkovskyi | 2 | 97.7% | 0.0 |
| Macrosiphum sp. BIOUG09180-F06 | 1 | 97.7% | 0.0 |
| Macrosiphum sp. BIOUG09174-G05 | 1 | 97.6% | 0.0 |
| Macrosiphum sp. C1774 | 1 | 97.5% | 0.0 |
| Macrosiphum daphnidis | 1 | 97.5% | 0.0 |
| Macrosiphum hellebori | 4 | 97.5% | 0.0 |
| Macrosiphum sp. | 1 | 97.5% | 0.0 |
| Macrosiphum gei | 1 | 97.39999999999999% | 0.0 |
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | KR577906 | Macrosiphum sp. BOLD-2016 voucher BIOUG09175-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 573 | 96.0% | 548.0 | 0.00e+00 | 98.1% |
| 2 | KR561551 | Macrosiphum sp. BOLD-2016 voucher BIOUG09174-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 98.8% | 563.0 | 0.00e+00 | 98.0% |
| 3 | KF639474 | Macrosiphum euphorbiae voucher INRA CBGP ACOE1129/chasses1129-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 566.0 | 0.00e+00 | 97.8% |
| 4 | KF639471 | Macrosiphum cholodkovskyi voucher INRA CBGP ACOE410/chasses410-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 563.0 | 0.00e+00 | 97.7% |
| 5 | MG508729 | Macrosiphum sp. BIOUG09180-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 546.0 | 0.00e+00 | 97.7% |
| 6 | KR561411 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 546.0 | 0.00e+00 | 97.7% |
| 7 | KR571940 | Macrosiphum sp. BOLD-2016 voucher BIOUG09178-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 544.0 | 0.00e+00 | 97.7% |
| 8 | KR583887 | Macrosiphum sp. BOLD-2016 voucher BIOUG09180-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 543.0 | 0.00e+00 | 97.7% |
| 9 | KR568678 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 543.0 | 0.00e+00 | 97.7% |
| 10 | KR567106 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 529 | 88.6% | 503.0 | 0.00e+00 | 97.7% |
| 11 | KR564232 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 559.0 | 0.00e+00 | 97.6% |
| 12 | MG512740 | Macrosiphum sp. BIOUG09174-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 543.0 | 0.00e+00 | 97.6% |
| 13 | KR582949 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 541.0 | 0.00e+00 | 97.6% |
| 14 | KR563625 | Macrosiphum sp. BOLD-2016 voucher BIOUG09178-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 540.0 | 0.00e+00 | 97.6% |
| 15 | KR567662 | Macrosiphum sp. BOLD-2016 voucher BIOUG09079-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 507.0 | 0.00e+00 | 97.6% |
| 16 | KF639482 | Macrosiphum euphorbiae voucher INRA CBGP ACOE1650/chasses1650-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 17 | MF140509 | Macrosiphum euphorbiae voucher GTB156DN1535 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 18 | MN320040 | Macrosiphum euphorbiae voucher NIBGE APH-00556 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 19 | KY323033 | Macrosiphum euphorbiae voucher MeKm5 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 20 | MN319903 | Macrosiphum euphorbiae voucher NIBGE APH-00554 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 21 | EU189671 | Macrosiphum sp. C1774 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 22 | KR032429 | Macrosiphum euphorbiae voucher CNC#HEM071402 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 23 | EU701729 | Macrosiphum euphorbiae voucher CNC#HEM051851 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 24 | KY323034 | Macrosiphum euphorbiae voucher MeKm3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 25 | MN320058 | Macrosiphum euphorbiae voucher NIBGE APH-00525 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 26 | MT821481 | Macrosiphum euphorbiae isolate Shimla cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 27 | KJ090564 | Macrosiphum euphorbiae voucher BIOUG03250-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 28 | MN319872 | Macrosiphum euphorbiae voucher NIBGE APH-00560 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 29 | EU701724 | Macrosiphum daphnidis voucher CNC#HEM054303 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 30 | MN319878 | Macrosiphum euphorbiae voucher NIBGE APH-00558 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 31 | MN320016 | Macrosiphum euphorbiae voucher NIBGE APH-00562 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 32 | KF639478 | Macrosiphum euphorbiae voucher INRA CBGP ACOE1232/chasses1232-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 33 | MN320310 | Macrosiphum euphorbiae voucher NIBGE APH-00561 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 34 | MZ486436 | Macrosiphum euphorbiae isolate AJ2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 35 | DQ499037 | Macrosiphum hellebori isolate 1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 36 | MK547613 | Macrosiphum euphorbiae isolate OAI721 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 37 | ON929000 | Macrosiphum hellebori cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 38 | GU668719 | Macrosiphum euphorbiae voucher CNC#HEM059982 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 39 | MT651328 | Macrosiphum euphorbiae isolate IND01DL cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 40 | MN320052 | Macrosiphum euphorbiae voucher NIBGE APH-00524 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 41 | MN320246 | Macrosiphum euphorbiae voucher NIBGE APH-00555 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 42 | KF639479 | Macrosiphum euphorbiae voucher INRA CBGP ACOE1248/chasses1248-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 43 | KF639472 | Macrosiphum euphorbiae voucher INRA CBGP ACOE1029/chasses1029-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 44 | MT516422 | Macrosiphum euphorbiae voucher GTB416DN3023 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 100.0% | 560.0 | 0.00e+00 | 97.5% |
| 45 | KX631509 | Macrosiphum hellebori cytochrome oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 596 | 99.8% | 559.0 | 0.00e+00 | 97.5% |
| 46 | KR574730 | Macrosiphum sp. BOLD-2016 voucher BIOUG09236-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 558.0 | 0.00e+00 | 97.5% |
| 47 | MN320256 | Macrosiphum euphorbiae voucher NIBGE APH-00208 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 555.0 | 0.00e+00 | 97.5% |
| 48 | ON929002 | Macrosiphum sp. cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 567 | 95.0% | 533.0 | 0.00e+00 | 97.5% |
| 49 | KR582542 | Macrosiphum sp. BOLD-2016 voucher BIOUG16018-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 95.0% | 532.0 | 0.00e+00 | 97.5% |
| 50 | KR560079 | Macrosiphum sp. BOLD-2016 voucher BIOUG08498-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 519.0 | 0.00e+00 | 97.5% |
| 51 | KR583697 | Macrosiphum sp. BOLD-2016 voucher BIOUG05111-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 516.0 | 0.00e+00 | 97.5% |
| 52 | KR560519 | Macrosiphum sp. BOLD-2016 voucher BIOUG05090-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 516.0 | 0.00e+00 | 97.5% |
| 53 | KR578840 | Macrosiphum sp. BOLD-2016 voucher BIOUG05111-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 516.0 | 0.00e+00 | 97.5% |
| 54 | KR566505 | Macrosiphum sp. BOLD-2016 voucher BIOUG05961-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 536.0 | 0.00e+00 | 97.4% |
| 55 | KR573985 | Macrosiphum sp. BOLD-2016 voucher BIOUG09174-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 573 | 96.0% | 536.0 | 0.00e+00 | 97.4% |
| 56 | KR582416 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 536.0 | 0.00e+00 | 97.4% |
| 57 | KR574090 | Macrosiphum sp. BOLD-2016 voucher BIOUG09237-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 536.0 | 0.00e+00 | 97.4% |
| 58 | KR565793 | Macrosiphum sp. BOLD-2016 voucher BIOUG09174-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 536.0 | 0.00e+00 | 97.4% |
| 59 | KR571108 | Macrosiphum sp. BOLD-2016 voucher BIOUG05152-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 536.0 | 0.00e+00 | 97.4% |
| 60 | KR583968 | Macrosiphum sp. BOLD-2016 voucher BIOUG09177-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 573 | 96.0% | 535.0 | 0.00e+00 | 97.4% |
| 61 | KR576529 | Macrosiphum sp. BOLD-2016 voucher BIOUG09180-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 573 | 96.0% | 535.0 | 0.00e+00 | 97.4% |
| 62 | KR562228 | Macrosiphum sp. BOLD-2016 voucher BIOUG05152-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 95.0% | 529.0 | 0.00e+00 | 97.4% |
| 63 | KR565822 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 91.3% | 513.0 | 0.00e+00 | 97.4% |
| 64 | KR029964 | Macrosiphum gei cytochrome c oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 545 | 91.3% | 511.0 | 0.00e+00 | 97.4% |
| 65 | KR571323 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 543 | 91.0% | 510.0 | 0.00e+00 | 97.4% |
| 66 | MF831153 | Macrosiphum sp. BIOUG20372-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 506.0 | 0.00e+00 | 97.4% |
| 67 | KF639473 | Macrosiphum euphorbiae voucher INRA CBGP ACOE1080/chasses1080-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 557.0 | 0.00e+00 | 97.3% |
| 68 | KR572605 | Macrosiphum sp. BOLD-2016 voucher 10BBCHEM-0260 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 557.0 | 0.00e+00 | 97.3% |
| 69 | MF831135 | Macrosiphum zionense voucher 10BBCHEM-0395 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 557.0 | 0.00e+00 | 97.3% |
| 70 | JF883839 | Macrosiphum euphorbiae voucher CNC#HEM070715 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 557.0 | 0.00e+00 | 97.3% |
| 71 | KR033248 | Macrosiphum euphorbiae voucher CNC#HEM056697 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 557.0 | 0.00e+00 | 97.3% |
| 72 | KR581782 | Macrosiphum sp. BOLD-2016 voucher 10BBCHEM-0587 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 557.0 | 0.00e+00 | 97.3% |
| 73 | KF639476 | Macrosiphum euphorbiae voucher INRA CBGP ACOE1195/chasses1195-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 557.0 | 0.00e+00 | 97.3% |
| 74 | MN319882 | Macrosiphum euphorbiae voucher NIBGE APH-00559 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 555.0 | 0.00e+00 | 97.3% |
| 75 | KR562935 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 97.5% | 544.0 | 0.00e+00 | 97.3% |
| 76 | KR574378 | Macrosiphum sp. BOLD-2016 voucher BIOUG05100-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 566 | 94.8% | 528.0 | 0.00e+00 | 97.3% |
| 77 | KR568068 | Macrosiphum zionense voucher BIOUG09237-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 564 | 94.5% | 526.0 | 0.00e+00 | 97.3% |
| 78 | KR573184 | Macrosiphum sp. BOLD-2016 voucher BIOUG09177-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 94.3% | 525.0 | 0.00e+00 | 97.3% |
| 79 | MH821971 | Macrosiphum euphorbiae voucher HL287 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 93.8% | 523.0 | 0.00e+00 | 97.3% |
| 80 | MH821976 | Macrosiphum euphorbiae voucher HLshujia6 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 93.8% | 523.0 | 0.00e+00 | 97.3% |
| 81 | MH821975 | Macrosiphum euphorbiae voucher HLshujia489 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 93.8% | 523.0 | 0.00e+00 | 97.3% |
| 82 | MF836451 | Macrosiphum sp. BIOUG21027-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 560 | 93.8% | 522.0 | 0.00e+00 | 97.3% |
| 83 | KR566048 | Macrosiphum zionense voucher BIOUG09237-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 93.5% | 520.0 | 0.00e+00 | 97.3% |
| 84 | KR562135 | Macrosiphum sp. BOLD-2016 voucher BIOUG09176-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 93.5% | 520.0 | 0.00e+00 | 97.3% |
| 85 | KR562213 | Macrosiphum sp. BOLD-2016 voucher BIOUG09177-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 556 | 93.1% | 518.0 | 0.00e+00 | 97.3% |
| 86 | KR578367 | Macrosiphum sp. BOLD-2016 voucher BIOUG09180-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 517.0 | 0.00e+00 | 97.3% |
| 87 | KR568358 | Macrosiphum sp. BOLD-2016 voucher BIOUG08862-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 517.0 | 0.00e+00 | 97.3% |
| 88 | KR578519 | Macrosiphum sp. BOLD-2016 voucher BIOUG09178-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 517.0 | 0.00e+00 | 97.3% |
| 89 | KR560199 | Macrosiphum sp. BOLD-2016 voucher BIOUG09176-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 517.0 | 0.00e+00 | 97.3% |
| 90 | KR560921 | Macrosiphum sp. BOLD-2016 voucher BIOUG09180-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 517.0 | 0.00e+00 | 97.3% |
| 91 | KR564592 | Macrosiphum sp. BOLD-2016 voucher BIOUG09174-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 517.0 | 0.00e+00 | 97.3% |
| 92 | KR564435 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 517.0 | 0.00e+00 | 97.3% |
| 93 | KR573332 | Macrosiphum sp. BOLD-2016 voucher BIOUG09180-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 517.0 | 0.00e+00 | 97.3% |
| 94 | KR564300 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 95 | KR564512 | Macrosiphum sp. BOLD-2016 voucher BIOUG09176-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 96 | KU567711 | Macrosiphum valerianae voucher BIOUG07986-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 97 | KR569912 | Macrosiphum sp. BOLD-2016 voucher BIOUG09180-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 98 | KR570039 | Macrosiphum sp. BOLD-2016 voucher BIOUG09180-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 99 | KR582841 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 100 | KR578432 | Macrosiphum sp. BOLD-2016 voucher BIOUG16021-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 101 | KR566668 | Macrosiphum sp. BOLD-2016 voucher BIOUG09175-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 102 | KR570813 | Macrosiphum sp. BOLD-2016 voucher BIOUG09161-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 103 | KR566041 | Macrosiphum sp. BOLD-2016 voucher BIOUG09174-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 104 | KR570790 | Macrosiphum sp. BOLD-2016 voucher BIOUG09177-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 516.0 | 0.00e+00 | 97.3% |
| 105 | KR569533 | Macrosiphum sp. BOLD-2016 voucher BIOUG09176-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 515.0 | 0.00e+00 | 97.3% |
| 106 | KR566372 | Macrosiphum sp. BOLD-2016 voucher BIOUG09461-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 515.0 | 0.00e+00 | 97.3% |
| 107 | KR574776 | Macrosiphum sp. BOLD-2016 voucher BIOUG08862-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 515.0 | 0.00e+00 | 97.3% |
| 108 | KR579600 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 548 | 91.8% | 515.0 | 0.00e+00 | 97.3% |
| 109 | KR562309 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 515.0 | 0.00e+00 | 97.3% |
| 110 | KR584355 | Macrosiphum sp. BOLD-2016 voucher BIOUG09237-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 515.0 | 0.00e+00 | 97.3% |
| 111 | KR582934 | Macrosiphum sp. BOLD-2016 voucher BIOUG09174-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 515.0 | 0.00e+00 | 97.3% |
| 112 | KR568666 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 515.0 | 0.00e+00 | 97.3% |
| 113 | KR568925 | Macrosiphum zionense voucher BIOUG09237-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 515.0 | 0.00e+00 | 97.3% |
| 114 | KR564912 | Macrosiphum zionense voucher BIOUG09237-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 515.0 | 0.00e+00 | 97.3% |
| 115 | KR572463 | Macrosiphum sp. BOLD-2016 voucher BIOUG09175-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 515.0 | 0.00e+00 | 97.3% |
| 116 | KR569287 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 552 | 92.5% | 514.0 | 0.00e+00 | 97.3% |
| 117 | KR565913 | Macrosiphum sp. BOLD-2016 voucher BIOUG09180-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 118 | KR566432 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 119 | KR570294 | Macrosiphum sp. BOLD-2016 voucher BIOUG08884-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 120 | KR572109 | Macrosiphum sp. BOLD-2016 voucher BIOUG09178-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 121 | KR567396 | Macrosiphum sp. BOLD-2016 voucher BIOUG05116-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 122 | KR578351 | Macrosiphum sp. BOLD-2016 voucher BIOUG05090-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 123 | KR581999 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 124 | KR563591 | Macrosiphum sp. BOLD-2016 voucher BIOUG05116-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 125 | KR577997 | Macrosiphum sp. BOLD-2016 voucher BIOUG09178-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 126 | KR565579 | Macrosiphum sp. BOLD-2016 voucher BIOUG09175-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 127 | KR569921 | Macrosiphum sp. BOLD-2016 voucher BIOUG08791-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 128 | KR560996 | Macrosiphum sp. BOLD-2016 voucher BIOUG16056-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 129 | KR565363 | Macrosiphum sp. BOLD-2016 voucher BIOUG08734-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 130 | KR576963 | Macrosiphum sp. BOLD-2016 voucher BIOUG09127-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 131 | KR568570 | Macrosiphum sp. BOLD-2016 voucher BIOUG16025-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 132 | KR566822 | Macrosiphum sp. BOLD-2016 voucher BIOUG05090-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 513.0 | 0.00e+00 | 97.3% |
| 133 | KR583060 | Macrosiphum sp. BOLD-2016 voucher BIOUG09175-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 549 | 92.0% | 511.0 | 0.00e+00 | 97.3% |
| 134 | KR563083 | Macrosiphum sp. BOLD-2016 voucher BIOUG05152-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 549 | 92.0% | 511.0 | 0.00e+00 | 97.3% |
| 135 | KU567850 | Macrosiphum valerianae voucher BIOUG07984-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 548 | 91.8% | 510.0 | 0.00e+00 | 97.3% |
| 136 | KR577762 | Macrosiphum sp. BOLD-2016 voucher BIOUG05100-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 548 | 91.8% | 510.0 | 0.00e+00 | 97.3% |
| 137 | KR029965 | Macrosiphum cholodkovskyi cytochrome c oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 545 | 91.3% | 508.0 | 0.00e+00 | 97.3% |
| 138 | KR029962 | Macrosiphum hellebori cytochrome c oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 545 | 91.3% | 508.0 | 0.00e+00 | 97.3% |
| 139 | KR031566 | Macrosiphum valerianae voucher 07PROBE-06673 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 140 | KR043726 | Macrosiphum valerianae voucher 07PROBE-06672 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 141 | JF883548 | Macrosiphum euphorbiae voucher CNC#HEM070251 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 142 | GU668156 | Macrosiphum sp. RFBAE016-09 voucher CNC#HEM062561 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 143 | EU701731 | Macrosiphum impatientis voucher CNC#HEM049306 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 144 | KR031932 | Macrosiphum valerianae voucher CNC#HEM057350 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 145 | KC502581 | Macrosiphum valerianae voucher CCDB-08110-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 146 | HQ961729 | Macrosiphum valerianae voucher BIOUG| 597 |
100.0% |
554.0 |
0.00e+00 |
97.2% |
|
| 147 | JF883800 | Macrosiphum euphorbiae voucher CNC#HEM070271 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 148 | GU668347 | Macrosiphum sp. RFBAE447-09 voucher CNC#HEM063457 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 149 | MF829503 | Macrosiphum sp. BIOUG26722-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 150 | NC_063971 | Macrosiphum albifrons mitochondrion, complete genome | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 151 | KF639487 | Macrosiphum euphorbiae voucher INRA CBGP ACOE838/chasses838-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 152 | HM416712 | Macrosiphum albifrons voucher CNC#HEM064255 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 153 | EU701721 | Macrosiphum albifrons voucher CNC#HEM015401 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 154 | KR567786 | Macrosiphum zionense voucher 10BBCHEM-0396 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 155 | KR572374 | Macrosiphum sp. BOLD-2016 voucher BIOUG09177-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.2% |
| 156 | KX631510 | Macrosiphum albifrons cytochrome oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 596 | 99.8% | 553.0 | 0.00e+00 | 97.2% |
| 157 | KR561590 | Macrosiphum sp. BOLD-2016 voucher BIOUG05152-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 577 | 96.6% | 537.0 | 0.00e+00 | 97.2% |
| 158 | KR564398 | Macrosiphum sp. BOLD-2016 voucher BIOUG07501-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 533.0 | 0.00e+00 | 97.2% |
| 159 | MF835506 | Macrosiphum sp. BIOUG26183-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 533.0 | 0.00e+00 | 97.2% |
| 160 | KR567953 | Macrosiphum sp. BOLD-2016 voucher BIOUG06252-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 532.0 | 0.00e+00 | 97.2% |
| 161 | KR574427 | Macrosiphum sp. BOLD-2016 voucher BIOUG04445-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 95.8% | 530.0 | 0.00e+00 | 97.2% |
| 162 | KR578767 | Macrosiphum sp. BOLD-2016 voucher BIOUG05445-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 95.3% | 528.0 | 0.00e+00 | 97.2% |
| 163 | KR564158 | Macrosiphum sp. BOLD-2016 voucher BIOUG07601-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 95.3% | 528.0 | 0.00e+00 | 97.2% |
| 164 | KR576967 | Macrosiphum sp. BOLD-2016 voucher BIOUG06688-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 568 | 95.1% | 526.0 | 0.00e+00 | 97.2% |
| 165 | KR562925 | Macrosiphum sp. BOLD-2016 voucher BIOUG05821-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 94.3% | 522.0 | 0.00e+00 | 97.2% |
| 166 | KU567769 | Macrosiphum euphorbiae voucher BIOUG07985-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 94.3% | 522.0 | 0.00e+00 | 97.2% |
| 167 | KR568798 | Macrosiphum sp. BOLD-2016 voucher BIOUG06245-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 94.3% | 521.0 | 0.00e+00 | 97.2% |
| 168 | KR567424 | Macrosiphum sp. BOLD-2016 voucher BIOUG04445-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 94.3% | 521.0 | 0.00e+00 | 97.2% |
| 169 | KR562006 | Macrosiphum zionense voucher BIOUG09237-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 91.3% | 507.0 | 0.00e+00 | 97.2% |
| 170 | KR575582 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 544 | 91.1% | 506.0 | 0.00e+00 | 97.2% |
| 171 | KR569966 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 504.0 | 0.00e+00 | 97.2% |
| 172 | KR570335 | Macrosiphum sp. BOLD-2016 voucher BIOUG09177-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 541 | 90.6% | 503.0 | 0.00e+00 | 97.2% |
| 173 | KU567701 | Macrosiphum euphorbiae voucher BIOUG07983-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 503.0 | 0.00e+00 | 97.2% |
| 174 | KR574362 | Macrosiphum sp. BOLD-2016 voucher BIOUG09174-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 541 | 90.6% | 503.0 | 0.00e+00 | 97.2% |
| 175 | KR562656 | Macrosiphum zionense voucher BIOUG09237-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 541 | 90.6% | 503.0 | 0.00e+00 | 97.2% |
| 176 | KR576511 | Macrosiphum sp. BOLD-2016 voucher BIOUG09177-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 501.0 | 0.00e+00 | 97.2% |
| 177 | KR576831 | Macrosiphum sp. BOLD-2016 voucher BIOUG09208-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 501.0 | 0.00e+00 | 97.2% |
| 178 | KU567726 | Macrosiphum euphorbiae voucher BIOUG07985-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 501.0 | 0.00e+00 | 97.2% |
| 179 | KR566097 | Macrosiphum sp. BOLD-2016 voucher BIOUG05091-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 501.0 | 0.00e+00 | 97.2% |
| 180 | KR570457 | Macrosiphum sp. BOLD-2016 voucher BIOUG16068-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 501.0 | 0.00e+00 | 97.2% |
| 181 | MF834126 | Macrosiphum sp. BIOUG21576-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 501.0 | 0.00e+00 | 97.2% |
| 182 | MF828765 | Macrosiphum sp. BIOUG26183-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 501.0 | 0.00e+00 | 97.2% |
| 183 | MF833312 | Macrosiphum sp. BIOUG23640-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 539 | 90.3% | 501.0 | 0.00e+00 | 97.2% |
| 184 | KR564917 | Macrosiphum zionense voucher BIOUG09237-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 538 | 90.1% | 500.0 | 0.00e+00 | 97.2% |
| 185 | MG507968 | Macrosiphum sp. BIOUG09236-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 555.0 | 0.00e+00 | 97.1% |
| 186 | HQ961731 | Macrosiphum valerianae voucher BIOUG| 595 |
99.7% |
552.0 |
0.00e+00 |
97.1% |
|
| 187 | KR571451 | Macrosiphum sp. BOLD-2016 voucher BIOUG07501-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 595 | 99.7% | 552.0 | 0.00e+00 | 97.1% |
| 188 | KR560243 | Macrosiphum sp. BOLD-2016 voucher BIOUG09177-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 550.0 | 0.00e+00 | 97.1% |
| 189 | KR037709 | Macrosiphum valerianae voucher CNC#HEM057312 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 550.0 | 0.00e+00 | 97.1% |
| 190 | KR583134 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 589 | 98.7% | 546.0 | 0.00e+00 | 97.1% |
| 191 | KR581005 | Macrosiphum sp. BOLD-2016 voucher BIOUG08884-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 587 | 98.3% | 544.0 | 0.00e+00 | 97.1% |
| 192 | ON928999 | Macrosiphum albifrons cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 586 | 98.2% | 543.0 | 0.00e+00 | 97.1% |
| 193 | MH821973 | Macrosiphum euphorbiae voucher HLshujia446 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 93.8% | 520.0 | 0.00e+00 | 97.1% |
| 194 | KR036947 | Macrosiphum euphorbiae voucher BIOUG09237-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 556 | 93.1% | 517.0 | 0.00e+00 | 97.1% |
| 195 | KR562019 | Macrosiphum sp. BOLD-2016 voucher BIOUG09175-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 93.5% | 517.0 | 0.00e+00 | 97.1% |
| 196 | KR568558 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 514.0 | 0.00e+00 | 97.1% |
| 197 | KR572280 | Macrosiphum sp. BOLD-2016 voucher BIOUG09236-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 514.0 | 0.00e+00 | 97.1% |
| 198 | KR571952 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 514.0 | 0.00e+00 | 97.1% |
| 199 | KR565489 | Macrosiphum sp. BOLD-2016 voucher BIOUG06245-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 93.0% | 513.0 | 0.00e+00 | 97.1% |
| 200 | MF836978 | Macrosiphum sp. BIOUG26183-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 513.0 | 0.00e+00 | 97.1% |
| 201 | MF828933 | Macrosiphum sp. BIOUG26722-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 513.0 | 0.00e+00 | 97.1% |
| 202 | KR570416 | Macrosiphum sp. BOLD-2016 voucher BIOUG09178-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 513.0 | 0.00e+00 | 97.1% |
| 203 | KR568581 | Macrosiphum sp. BOLD-2016 voucher BIOUG18091-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 513.0 | 0.00e+00 | 97.1% |
| 204 | KR564291 | Macrosiphum sp. BOLD-2016 voucher BIOUG09175-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 513.0 | 0.00e+00 | 97.1% |
| 205 | KR562864 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 513.0 | 0.00e+00 | 97.1% |
| 206 | KR572005 | Macrosiphum zionense voucher BIOUG09237-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 512.0 | 0.00e+00 | 97.1% |
| 207 | KR577237 | Macrosiphum sp. BOLD-2016 voucher BIOUG06358-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 512.0 | 0.00e+00 | 97.1% |
| 208 | KR571203 | Macrosiphum zionense voucher BIOUG09681-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 512.0 | 0.00e+00 | 97.1% |
| 209 | KR560943 | Macrosiphum sp. BOLD-2016 voucher BIOUG06641-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 512.0 | 0.00e+00 | 97.1% |
| 210 | KR572276 | Macrosiphum sp. BOLD-2016 voucher BIOUG05834-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 512.0 | 0.00e+00 | 97.1% |
| 211 | KR583342 | Macrosiphum sp. BOLD-2016 voucher BIOUG08862-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 511.0 | 0.00e+00 | 97.1% |
| 212 | KR571434 | Macrosiphum sp. BOLD-2016 voucher BIOUG09178-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 511.0 | 0.00e+00 | 97.1% |
| 213 | MF837961 | Macrosiphum sp. BIOUG26183-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 510.0 | 0.00e+00 | 97.1% |
| 214 | MF833630 | Macrosiphum sp. BIOUG26722-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 510.0 | 0.00e+00 | 97.1% |
| 215 | KR561943 | Macrosiphum sp. BOLD-2016 voucher BIOUG08388-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 510.0 | 0.00e+00 | 97.1% |
| 216 | KR562775 | Macrosiphum sp. BOLD-2016 voucher BIOUG09177-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 510.0 | 0.00e+00 | 97.1% |
| 217 | KR578586 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 510.0 | 0.00e+00 | 97.1% |
| 218 | KR570367 | Macrosiphum sp. BOLD-2016 voucher BIOUG06245-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 509.0 | 0.00e+00 | 97.1% |
| 219 | KR571560 | Macrosiphum sp. BOLD-2016 voucher BIOUG06245-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 509.0 | 0.00e+00 | 97.1% |
| 220 | KR564032 | Macrosiphum sp. BOLD-2016 voucher BIOUG06252-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 509.0 | 0.00e+00 | 97.1% |
| 221 | KR581824 | Macrosiphum sp. BOLD-2016 voucher BIOUG06251-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 509.0 | 0.00e+00 | 97.1% |
| 222 | KR570106 | Macrosiphum sp. BOLD-2016 voucher BIOUG09461-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 509.0 | 0.00e+00 | 97.1% |
| 223 | KR561390 | Macrosiphum sp. BOLD-2016 voucher BIOUG04446-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 509.0 | 0.00e+00 | 97.1% |
| 224 | KR581507 | Macrosiphum sp. BOLD-2016 voucher BIOUG06252-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 550 | 92.1% | 508.0 | 0.00e+00 | 97.1% |
| 225 | KR561968 | Macrosiphum sp. BOLD-2016 voucher BIOUG06251-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 549 | 92.0% | 507.0 | 0.00e+00 | 97.1% |
| 226 | KR570926 | Macrosiphum sp. BOLD-2016 voucher BIOUG06391-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 546 | 91.5% | 506.0 | 0.00e+00 | 97.1% |
| 227 | KR567736 | Macrosiphum sp. BOLD-2016 voucher BIOUG09178-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 546 | 91.5% | 505.0 | 0.00e+00 | 97.1% |
| 228 | KR561445 | Macrosiphum sp. BOLD-2016 voucher BIOUG09180-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 546 | 91.5% | 505.0 | 0.00e+00 | 97.1% |
| 229 | HQ971295 | Macrosiphum euphorbiae voucher CNC#HEM068385 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 554.0 | 0.00e+00 | 97.0% |
| 230 | JF883652 | Macrosiphum euphorbiae voucher CNC#HEM070400 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 552.0 | 0.00e+00 | 97.0% |
| 231 | DQ499036 | Macrosiphum euphorbiae cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 232 | KR577761 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 233 | KR583033 | Macrosiphum sp. BOLD-2016 voucher 10BBCHEM-0342 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 234 | MF835822 | Macrosiphum sp. BIOUG21830-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 235 | KR031540 | Macrosiphum gaurae voucher CNC#HEM061500 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 236 | MF838504 | Macrosiphum sp. BIOUG21830-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 237 | KR038728 | Catamergus fulvae voucher CNC#HEM072441 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 238 | OP373188 | Macrosiphum euphorbiae isolate ME-IARI-DL-1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 239 | KC008068 | Macrosiphum euphorbiae cytochrome oxidase subunit I gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 240 | KR036935 | Macrosiphum valerianae voucher CNC#HEM057642 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 241 | GU668535 | Macrosiphum sp. RFBAE652-09 voucher CNC#HEM063634 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 242 | ON929001 | Macrosiphum euphorbiae cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 243 | KR574967 | Macrosiphum sp. BOLD-2016 voucher BIOUG07601-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 244 | KC502575 | Macrosiphum euphorbiae voucher CCDB-08110-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 245 | KY613938 | Macrosiphum euphorbiae isolate Shimla A7 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 246 | KR041292 | Macrosiphum valerianae voucher CNC#HEM057644 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 247 | KR041412 | Macrosiphum valerianae voucher CNC#HEM062501 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 248 | EU701726 | Macrosiphum euphorbiae voucher CNC#HEM055861 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 249 | GU978930 | Macrosiphum euphorbiae isolate 030625S34 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 250 | GU668394 | Macrosiphum euphorbiae voucher CNC#HEM063886 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 251 | KR036656 | Macrosiphum euphorbiae voucher CNC#HEM071356 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 252 | HQ971305 | Macrosiphum valerianae voucher CNC#HEM068396 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 551.0 | 0.00e+00 | 97.0% |
| 253 | KR581425 | Macrosiphum sp. BOLD-2016 voucher BIOUG09300-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 99.8% | 550.0 | 0.00e+00 | 97.0% |
| 254 | KX631511 | Macrosiphum euphorbiae cytochrome oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 596 | 99.8% | 550.0 | 0.00e+00 | 97.0% |
| 255 | KR561705 | Macrosiphum zionense voucher 10BBCHEM-0589 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 550.0 | 0.00e+00 | 97.0% |
| 256 | KR036352 | Macrosiphum valerianae voucher CNC#HEM057286 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 548.0 | 0.00e+00 | 97.0% |
| 257 | HM416713 | Catamergus fulvae voucher CNC#HEM064256 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 547.0 | 0.00e+00 | 97.0% |
| 258 | KR570213 | Macrosiphum sp. BOLD-2016 voucher BIOUG07601-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 547.0 | 0.00e+00 | 97.0% |
| 259 | KR041386 | Macrosiphum euphorbiae voucher CNC#HEM057646 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 547.0 | 0.00e+00 | 97.0% |
| 260 | KR568024 | Macrosiphum sp. BOLD-2016 voucher BIOUG04396-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 546.0 | 0.00e+00 | 97.0% |
| 261 | MF834117 | Macrosiphum sp. BIOUG26722-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 546.0 | 0.00e+00 | 97.0% |
| 262 | OL711736 | Macrosiphum euphorbiae isolate A21 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 590 | 98.8% | 544.0 | 0.00e+00 | 97.0% |
| 263 | KR566590 | Macrosiphum sp. BOLD-2016 voucher BIOUG07601-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 98.8% | 544.0 | 0.00e+00 | 97.0% |
| 264 | KR567128 | Macrosiphum sp. BOLD-2016 voucher BIOUG09178-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 533.0 | 0.00e+00 | 97.0% |
| 265 | MF831037 | Macrosiphum sp. BIOUG26183-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 95.8% | 531.0 | 0.00e+00 | 97.0% |
| 266 | KR582544 | Macrosiphum sp. BOLD-2016 voucher BIOUG09300-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 530.0 | 0.00e+00 | 97.0% |
| 267 | KR037372 | Macrosiphum euphorbiae voucher BIOUG09237-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 573 | 96.0% | 530.0 | 0.00e+00 | 97.0% |
| 268 | KR572540 | Macrosiphum sp. BOLD-2016 voucher BIOUG06641-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 530.0 | 0.00e+00 | 97.0% |
| 269 | KR577881 | Macrosiphum sp. BOLD-2016 voucher BIOUG03160-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 530.0 | 0.00e+00 | 97.0% |
| 270 | KR579331 | Macrosiphum sp. BOLD-2016 voucher BIOUG06688-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 573 | 96.0% | 529.0 | 0.00e+00 | 97.0% |
| 271 | KR582807 | Macrosiphum sp. BOLD-2016 voucher BIOUG06688-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 95.5% | 526.0 | 0.00e+00 | 97.0% |
| 272 | MG167777 | Macrosiphum sp. BIOUG25565-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 95.3% | 525.0 | 0.00e+00 | 97.0% |
| 273 | MG166847 | Macrosiphum sp. BIOUG25045-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 95.0% | 524.0 | 0.00e+00 | 97.0% |
| 274 | KR576961 | Macrosiphum sp. BOLD-2016 voucher BIOUG04745-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 94.3% | 519.0 | 0.00e+00 | 97.0% |
| 275 | KR581469 | Macrosiphum sp. BOLD-2016 voucher BIOUG05116-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 560 | 93.8% | 516.0 | 0.00e+00 | 97.0% |
| 276 | KU567773 | Macrosiphum euphorbiae voucher BIOUG07984-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 560 | 93.8% | 516.0 | 0.00e+00 | 97.0% |
| 277 | MF836645 | Macrosiphum sp. BIOUG20896-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 589 | 98.7% | 546.0 | 0.00e+00 | 96.9% |
| 278 | OL711738 | Macrosiphum euphorbiae isolate A24 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 588 | 98.5% | 542.0 | 0.00e+00 | 96.9% |
| 279 | KR571708 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 584 | 97.8% | 539.0 | 0.00e+00 | 96.9% |
| 280 | OL711737 | Macrosiphum euphorbiae isolate A23 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 585 | 98.0% | 539.0 | 0.00e+00 | 96.9% |
| 281 | KR565747 | Macrosiphum sp. BOLD-2016 voucher BIOUG09179-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 97.5% | 536.0 | 0.00e+00 | 96.9% |
| 282 | KR584550 | Macrosiphum sp. BOLD-2016 voucher BIOUG04572-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 574 | 96.1% | 528.0 | 0.00e+00 | 96.9% |
| 283 | KR564349 | Macrosiphum sp. BOLD-2016 voucher BIOUG05956-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 556 | 93.1% | 514.0 | 0.00e+00 | 96.9% |
| 284 | KR568573 | Macrosiphum sp. BOLD-2016 voucher BIOUG09173-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 512.0 | 0.00e+00 | 96.9% |
| 285 | KR579690 | Macrosiphum sp. BOLD-2016 voucher BIOUG08403-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 556 | 93.1% | 512.0 | 0.00e+00 | 96.9% |
| 286 | KU567723 | Macrosiphum euphorbiae voucher BIOUG07985-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 510.0 | 0.00e+00 | 96.9% |
| 287 | MF837430 | Macrosiphum sp. BIOUG24347-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 510.0 | 0.00e+00 | 96.9% |
| 288 | KR563551 | Macrosiphum sp. BOLD-2016 voucher BIOUG09461-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 510.0 | 0.00e+00 | 96.9% |
| 289 | KR573371 | Macrosiphum sp. BOLD-2016 voucher BIOUG06422-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 510.0 | 0.00e+00 | 96.9% |
| 290 | KU567855 | Macrosiphum euphorbiae voucher BIOUG07984-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 510.0 | 0.00e+00 | 96.9% |
| 291 | KR575864 | Macrosiphum sp. BOLD-2016 voucher BIOUG06641-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 510.0 | 0.00e+00 | 96.9% |
| 292 | MG165891 | Macrosiphum sp. BIOUG25563-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 510.0 | 0.00e+00 | 96.9% |
| 293 | KU567969 | Macrosiphum euphorbiae voucher BIOUG07984-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 510.0 | 0.00e+00 | 96.9% |
| 294 | KR582845 | Macrosiphum sp. BOLD-2016 voucher BIOUG06640-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 509.0 | 0.00e+00 | 96.9% |
| 295 | KR573905 | Macrosiphum sp. BOLD-2016 voucher BIOUG05090-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 509.0 | 0.00e+00 | 96.9% |
| 296 | KU567939 | Macrosiphum euphorbiae voucher BIOUG07984-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 508.0 | 0.00e+00 | 96.9% |
| 297 | KR568823 | Macrosiphum sp. BOLD-2016 voucher BIOUG09208-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 507.0 | 0.00e+00 | 96.9% |
| 298 | KR566870 | Macrosiphum sp. BOLD-2016 voucher BIOUG06641-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 507.0 | 0.00e+00 | 96.9% |
| 299 | MG170881 | Macrosiphum sp. BIOUG22056-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 507.0 | 0.00e+00 | 96.9% |
| 300 | KR571002 | Macrosiphum sp. BOLD-2016 voucher BIOUG16130-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 507.0 | 0.00e+00 | 96.9% |
| 301 | KR577674 | Macrosiphum sp. BOLD-2016 voucher BIOUG05092-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 507.0 | 0.00e+00 | 96.9% |
| 302 | KU567745 | Macrosiphum euphorbiae voucher BIOUG07985-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 507.0 | 0.00e+00 | 96.9% |
| 303 | KU567717 | Macrosiphum euphorbiae voucher BIOUG07986-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 507.0 | 0.00e+00 | 96.9% |
| 304 | KR576891 | Macrosiphum sp. BOLD-2016 voucher BIOUG06252-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 549 | 92.0% | 505.0 | 0.00e+00 | 96.9% |
| 305 | MG167251 | Macrosiphum sp. BIOUG25563-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 548 | 91.8% | 504.0 | 0.00e+00 | 96.9% |
| 306 | KR029961 | Macrosiphum albifrons cytochrome c oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 545 | 91.3% | 502.0 | 0.00e+00 | 96.9% |
| 307 | KR567719 | Macrosiphum sp. BOLD-2016 voucher BIOUG06010-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 546 | 91.5% | 502.0 | 0.00e+00 | 96.9% |
| 308 | KR029963 | Macrosiphum euphorbiae cytochrome c oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 545 | 91.3% | 502.0 | 0.00e+00 | 96.9% |
| 309 | KR584254 | Macrosiphum sp. BOLD-2016 voucher BIOUG06252-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 91.3% | 501.0 | 0.00e+00 | 96.9% |
| 310 | EU701739 | Macrosiphum sp. C RGF-2008 voucher CNC#HEM012147 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 549.0 | 0.00e+00 | 96.8% |
| 311 | KR039959 | Macrosiphum valerianae voucher BIOUG02022-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 548.0 | 0.00e+00 | 96.8% |
| 312 | FN868602 | Macrosiphum sp. AK-2010 partial COI gene for cytochrome oxidase subunit 1 | 597 | 100.0% | 548.0 | 0.00e+00 | 96.8% |
| 313 | KR037439 | Macrosiphum euphorbiae voucher 10BBCHEM-0973 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 548.0 | 0.00e+00 | 96.8% |
| 314 | KR574746 | Macrosiphum sp. BOLD-2016 voucher BIOUG09176-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 548.0 | 0.00e+00 | 96.8% |
| 315 | JQ070055 | Macrosiphum euphorbiae cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 548.0 | 0.00e+00 | 96.8% |
| 316 | GU668716 | Macrosiphum euphorbiae voucher CNC#HEM063723 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 548.0 | 0.00e+00 | 96.8% |
| 317 | GU668714 | Macrosiphum valerianae voucher CNC#HEM063727 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 548.0 | 0.00e+00 | 96.8% |
| 318 | KR034753 | Macrosiphum euphorbiae voucher CNC#HEM057223 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 548.0 | 0.00e+00 | 96.8% |
| 319 | KR576248 | Macrosiphum sp. BOLD-2016 voucher 10BBCHEM-0970 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 547.0 | 0.00e+00 | 96.8% |
| 320 | MG169126 | Macrosiphum sp. BIOUG23681-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 543.0 | 0.00e+00 | 96.8% |
| 321 | GU668217 | Macrosiphum euphorbiae voucher CNC#HEM064078 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 98.8% | 541.0 | 0.00e+00 | 96.8% |
| 322 | KR564782 | Macrosiphum sp. BOLD-2016 voucher BIOUG06422-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 95.3% | 523.0 | 0.00e+00 | 96.8% |
| 323 | KR572151 | Macrosiphum sp. BOLD-2016 voucher BIOUG06637-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 561 | 94.0% | 516.0 | 0.00e+00 | 96.8% |
| 324 | KR032005 | Macrosiphum euphorbiae voucher CNC#HEM057310 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 94.3% | 516.0 | 0.00e+00 | 96.8% |
| 325 | MH821972 | Macrosiphum euphorbiae voucher HLshujia405 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 559 | 93.6% | 513.0 | 0.00e+00 | 96.8% |
| 326 | KR564626 | Macrosiphum sp. BOLD-2016 voucher BIOUG04984-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 557 | 93.3% | 510.0 | 0.00e+00 | 96.8% |
| 327 | MG168831 | Macrosiphum sp. BIOUG25563-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 508.0 | 0.00e+00 | 96.8% |
| 328 | MG164143 | Aphidinae sp. BIOUG31055-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 507.0 | 0.00e+00 | 96.8% |
| 329 | KR580260 | Macrosiphum sp. BOLD-2016 voucher BIOUG06358-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 92.8% | 507.0 | 0.00e+00 | 96.8% |
| 330 | JF883537 | Macrosiphum valerianae voucher CNC#HEM070236 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 545.0 | 0.00e+00 | 96.7% |
| 331 | KR035269 | Macrosiphum gaurae voucher CNC#HEM071420 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 545.0 | 0.00e+00 | 96.7% |
| 332 | JF883831 | Macrosiphum euphorbiae voucher CNC#HEM070691 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 545.0 | 0.00e+00 | 96.7% |
| 333 | EU701727 | Macrosiphum euphorbiae voucher CNC#HEM113479 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 545.0 | 0.00e+00 | 96.7% |
| 334 | HQ970686 | Macrosiphum sp. RDBAB1065-10 voucher CNC#HEM070222 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 545.0 | 0.00e+00 | 96.7% |
| 335 | KR568504 | Macrosiphum sp. BOLD-2016 voucher BIOUG06358-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 551 | 92.3% | 504.0 | 0.00e+00 | 96.7% |
| 336 | KR561585 | Macrosiphum sp. BOLD-2016 voucher BIOUG16097-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 548 | 91.8% | 501.0 | 0.00e+00 | 96.7% |
| 337 | KR566213 | Macrosiphum sp. BOLD-2016 voucher BIOUG06311-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 546 | 91.5% | 500.0 | 0.00e+00 | 96.7% |
| 338 | KR561015 | Macrosiphum sp. BOLD-2016 voucher BIOUG06422-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 568 | 95.1% | 517.0 | 0.00e+00 | 96.5% |
| 339 | KU567929 | Macrosiphum sp. BIOUG07985-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 557 | 93.3% | 504.0 | 0.00e+00 | 96.4% |
| 340 | KR562525 | Macrosiphum sp. BOLD-2016 voucher BIOUG06688-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 553 | 92.6% | 503.0 | 0.00e+00 | 96.4% |
| 341 | JX507424 | Macrosiphum funestum voucher A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 524.0 | 0.00e+00 | 95.6% |
| 342 | KJ502205 | Macrosiphum rosae voucher 110921WH12 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 524.0 | 0.00e+00 | 95.6% |
| 343 | KF639490 | Macrosiphum funestum voucher INRA CBGP ACOE2011/chasses2011-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 524.0 | 0.00e+00 | 95.6% |
| 344 | NC_064372 | Macrosiphum rosae mitochondrion, complete genome | 594 | 99.5% | 524.0 | 0.00e+00 | 95.6% |
| 345 | ON928998 | Macrosiphum rosae cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 594 | 99.5% | 524.0 | 0.00e+00 | 95.6% |
| 346 | KM115469 | Sitobion rosivorum voucher ZMIOZ LY102 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 524.0 | 0.00e+00 | 95.6% |
| 347 | KF639491 | Macrosiphum funestum voucher INRA CBGP ACOE2049/chasses2049-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 524.0 | 0.00e+00 | 95.6% |
| 348 | GU978952 | Macrosiphum mordvilkoi isolate 030625S09 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 594 | 99.5% | 524.0 | 0.00e+00 | 95.6% |
| 349 | ON928997 | Macrosiphum funestum cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 593 | 99.3% | 523.0 | 0.00e+00 | 95.6% |
| 350 | KR570763 | Macrosiphum sp. BOLD-2016 voucher 10BBCHEM-0749 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 526.0 | 0.00e+00 | 95.5% |
| 351 | KR571305 | Macrosiphum sp. BOLD-2016 voucher BIOUG07700-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 524.0 | 0.00e+00 | 95.5% |
| 352 | EU701734 | Macrosiphum rosae voucher CNC#HEM056001 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 353 | KT875239 | Macrosiphum rosae cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 354 | OP179318 | Macrosiphum pachysiphon isolate AphidRose6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 355 | OP164555 | Macrosiphum rosae isolate Aphid6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 356 | MT302339 | Macrosiphum rosae voucher r1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 357 | EU701733 | Macrosiphum rosae voucher CNC#HEM049346 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 358 | DQ499035 | Macrosiphum rosae cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 359 | KM115470 | Sitobion rosivorum voucher ZMIOZ LY099 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 360 | MN319988 | Macrosiphum rosae voucher NIBGE APH-00516 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 361 | OR858844 | Macrosiphum rosae voucher mr13 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 594 | 99.5% | 521.0 | 0.00e+00 | 95.5% |
| 362 | GU978874 | Macrosiphum mordvilkoi isolate 030625S64 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 580 | 97.2% | 510.0 | 0.00e+00 | 95.5% |
| 363 | MH407728 | Macrosiphum rosae isolate MR8_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 519.0 | 0.00e+00 | 95.4% |
| 364 | MH407727 | Macrosiphum rosae isolate MR9_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 519.0 | 0.00e+00 | 95.4% |
| 365 | KU374293 | Acyrthosiphon sp. 1 HKW-2016 voucher ZA2011-30329 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 518.0 | 0.00e+00 | 95.2% |
| 366 | JX507423 | Macrosiphum ptericolens voucher A18 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 518.0 | 0.00e+00 | 95.2% |
| 367 | HM416694 | Macrosiphum ptericolens voucher CNC#HEM064236 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 517.0 | 0.00e+00 | 95.2% |
| 368 | KR035873 | Macrosiphum ptericolens voucher BIOUG02608-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 517.0 | 0.00e+00 | 95.2% |
| 369 | KR042847 | Macrosiphum woodsiae voucher CNC#HEM062497 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 517.0 | 0.00e+00 | 95.2% |
| 370 | HQ112192 | Macrosiphum rosae voucher ORP-2010-57 cytochrome oxidase subunit I (COX1) gene, partial cds; mitochondrial | 594 | 99.5% | 515.0 | 0.00e+00 | 95.1% |
| 371 | KR036808 | Illinoia paqueti voucher CNC#HEM057226 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 515.0 | 0.00e+00 | 95.0% |
| 372 | EU701276 | Acyrthosiphon malvae voucher CNC#HEM011135 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 515.0 | 0.00e+00 | 95.0% |
| 373 | HM432520 | Macrosiphum sp. RFBAE448-09 voucher CNC#HEM063458 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 515.0 | 0.00e+00 | 95.0% |
| 374 | KJ093147 | Acyrthosiphon malvae voucher BIOUG02980-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 512.0 | 0.00e+00 | 95.0% |
| 375 | FJ752013 | Aulacorthum ligularicola cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 594 | 99.5% | 511.0 | 0.00e+00 | 95.0% |
| 376 | MF837512 | Acyrthosiphon malvae voucher BIOUG22539-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 510.0 | 0.00e+00 | 94.9% |
| 377 | KR581323 | Macrosiphum sp. BOLD-2016 voucher BIOUG13141-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 583 | 97.7% | 501.0 | 0.00e+00 | 94.9% |
| 378 | KR575358 | Metopolophium sp. BOLD-2016 voucher 10BBCHEM-0532 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 512.0 | 0.00e+00 | 94.8% |
| 379 | GU668337 | Acyrthosiphon assiniboinense voucher CNC#HEM063385 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 512.0 | 0.00e+00 | 94.8% |
| 380 | GU978951 | Macrosiphum clematifoliae isolate 031009S29 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 597 | 100.0% | 512.0 | 0.00e+00 | 94.8% |
| 381 | HQ970792 | Acyrthosiphon purshiae voucher CNC#HEM069913 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 512.0 | 0.00e+00 | 94.8% |
| 382 | KC502489 | Illinoia paqueti voucher CCDB-08110-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 512.0 | 0.00e+00 | 94.8% |
| 383 | KR037807 | Macrosiphum osmaroniae voucher CNC#HEM061895 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 512.0 | 0.00e+00 | 94.8% |
| 384 | KC502488 | Illinoia sp. BOLD:AAD8584 voucher CCDB-08110-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 512.0 | 0.00e+00 | 94.8% |
| 385 | GU668343 | Acyrthosiphon assiniboinense voucher CNC#HEM063469 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 512.0 | 0.00e+00 | 94.8% |
| 386 | HQ578909 | Acyrthosiphon malvae voucher CNC#HEM049357 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 512.0 | 0.00e+00 | 94.8% |
| 387 | KR042146 | Acyrthosiphon assiniboinense voucher BIOUG03331-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 595 | 99.7% | 510.0 | 0.00e+00 | 94.8% |
| 388 | FJ982384 | Aulacorthum albimagnoliae cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 509.0 | 0.00e+00 | 94.8% |
| 389 | GU978914 | Aulacorthum albimagnoliae isolate 040603S01 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 594 | 99.5% | 509.0 | 0.00e+00 | 94.8% |
| 390 | KR032530 | Macrosiphum pseudocoryli voucher BIOUG07501-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 99.0% | 508.0 | 0.00e+00 | 94.8% |
| 391 | KR036668 | Macrosiphum pseudocoryli voucher BIOUG07501-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 508.0 | 0.00e+00 | 94.8% |
| 392 | GU978915 | Aulacorthum albimagnoliae isolate 041006S01 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 593 | 99.3% | 508.0 | 0.00e+00 | 94.8% |
| 393 | FJ752005 | Aulacorthum albimagnoliae cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 593 | 99.3% | 508.0 | 0.00e+00 | 94.8% |
| 394 | KR035387 | Acyrthosiphon purshiae voucher CNC#HEM028645 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 507.0 | 0.00e+00 | 94.8% |
| 395 | KR035080 | Macrosiphum pseudocoryli voucher BIOUG09176-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 99.0% | 506.0 | 0.00e+00 | 94.8% |
| 396 | OL823183 | Macrosiphum rosae voucher Macrosiphum-rosae-KSA-taif cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 586 | 98.2% | 501.0 | 0.00e+00 | 94.7% |
| 397 | KR033284 | Macrosiphum pseudocoryli voucher 10BBCHEM-0125 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 398 | KR038570 | Illinoia menziesiae voucher CNC#HEM072176 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 399 | KR040402 | Macrosiphum osmaroniae voucher 10BBCHEM-0930 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 400 | KR040012 | Cryptomyzus galeopsidis voucher BIOUG00806-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 401 | MN319864 | Acyrthosiphon malvae voucher NIBGE APH-00474 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 402 | KR569639 | Illinoia sp. BOLD-2016 voucher BIOUG09300-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 403 | KR570878 | Metopolophium sp. BOLD-2016 voucher 10BBCHEM-0870 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 404 | KR032810 | Illinoia richardsi voucher 10BBCHEM-0201 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 405 | KR038757 | Illinoia paqueti voucher BIOUG02055-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 406 | MN320268 | Acyrthosiphon malvae voucher NIBGE APH-00483 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 407 | KR579419 | Metopolophium sp. BOLD-2016 voucher 10BBCHEM-0780 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 408 | MG165135 | Aphidinae sp. BIOUG25623-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 409 | HQ970634 | Cryptomyzus galeopsidis voucher CNC#HEM070087 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 410 | KR044214 | Illinoia richardsi voucher 10BBCHEM-0202 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 411 | EU701285 | Acyrthosiphon purshiae voucher CNC#HEM028871 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 412 | KF638721 | Acyrthosiphon lambersi voucher INRA CBGP ACOE1056/chasses1056-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 413 | EU701289 | Amphorophora nr. geranii BOLD:AAC4602 voucher CNC#HEM028840 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 414 | KR035956 | Macrosiphum pseudocoryli voucher CNC#HEM061335 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 415 | GU667451 | Macrosiphum pseudocoryli voucher CNC#HEM063177 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 416 | MN319844 | Acyrthosiphon malvae voucher NIBGE APH-00314 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 417 | EU701290 | Amphorophora nr. geranii BOLD:AAC4602 voucher CNC#HEM032928 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 418 | MN320275 | Acyrthosiphon malvae voucher NIBGE APH-00448 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 419 | MF837207 | Aphidinae sp. BIOUG27106-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 420 | MN320176 | Acyrthosiphon malvae voucher NIBGE APH-00479 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 509.0 | 0.00e+00 | 94.6% |
| 421 | KR044834 | Macrosiphum pseudocoryli voucher BIOUG07601-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 99.0% | 507.0 | 0.00e+00 | 94.6% |
| 422 | KR037957 | Macrosiphum pseudocoryli voucher BIOUG09208-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 99.0% | 507.0 | 0.00e+00 | 94.6% |
| 423 | KR032153 | Macrosiphum pseudocoryli voucher BIOUG07501-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 595 | 99.7% | 507.0 | 0.00e+00 | 94.6% |
| 424 | KF639335 | Corylobium avellanae voucher INRA CBGP ACOE762/chasses762-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 99.5% | 506.0 | 0.00e+00 | 94.6% |
| 425 | KR039643 | Macrosiphum pseudocoryli voucher BIOUG06901-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 98.8% | 506.0 | 0.00e+00 | 94.6% |
| 426 | KR036302 | Macrosiphum pseudocoryli voucher BIOUG09300-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 99.0% | 506.0 | 0.00e+00 | 94.6% |
| 427 | KR042786 | Macrosiphum pseudocoryli voucher BIOUG07601-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 99.0% | 506.0 | 0.00e+00 | 94.6% |
| 428 | KR033051 | Acyrthosiphon assiniboinense voucher BIOUG03941-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 505.0 | 0.00e+00 | 94.6% |
| 429 | MN319900 | Acyrthosiphon malvae voucher NIBGE APH-00210 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 504.0 | 0.00e+00 | 94.6% |
| 430 | KR031544 | Macrosiphum pseudocoryli voucher BIOUG07601-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 99.0% | 504.0 | 0.00e+00 | 94.6% |
| 431 | KR040578 | Acyrthosiphon assiniboinense voucher BIOUG03938-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 589 | 98.7% | 501.0 | 0.00e+00 | 94.6% |
| 432 | HQ970768 | Acyrthosiphon purshiae voucher CNC#HEM069885 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 508.0 | 0.00e+00 | 94.5% |
| 433 | KR578857 | Metopolophium sp. BOLD-2016 voucher 10BBCHEM-0531 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 507.0 | 0.00e+00 | 94.5% |
| 434 | EU701741 | Macrosiphum stanleyi voucher CNC#HEM051392 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 435 | KR561930 | Metopolophium sp. BOLD-2016 voucher 10BBCHEM-0867 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 436 | KR032757 | Macrosiphum stanleyi voucher CNC#HEM057555 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 437 | KR041411 | Illinoia richardsi voucher CNC#HEM056859 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 438 | KR035887 | Illinoia menziesiae voucher CNC#HEM072159 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 439 | KR031384 | Illinoia goldamaryae voucher BIOUG09681-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 440 | JF883610 | Macrosiphum stanleyi voucher CNC#HEM070338 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 441 | KR032529 | Illinoia spiraecola voucher 10BBCHEM-0935 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 442 | KR034565 | Macrosiphum californicum voucher CNC#HEM028981 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 443 | KR030887 | Illinoia goldamaryae voucher CNC#HEM062503 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 444 | HQ971317 | Macrosiphum californicum voucher CNC#HEM068410 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 445 | EU701740 | Macrosiphum stanleyi voucher CNC#HEM112723 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 446 | GU668720 | Illinoia goldamaryae voucher CNC#HEM061252 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 447 | KR036185 | Macrosiphum californicum voucher CNC#HEM057574 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 448 | EU701706 | Illinoia goldamaryae voucher CNC#HEM113458 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 449 | KR560827 | Illinoia sp. BOLD-2016 voucher BIOUG09300-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 506.0 | 0.00e+00 | 94.5% |
| 450 | KC502063 | Aphidinae sp. BOLD:ABZ4541 voucher CCDB-08110-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 505.0 | 0.00e+00 | 94.5% |
| 451 | KR568699 | Illinoia sp. BOLD-2016 voucher BIOUG09300-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 99.8% | 505.0 | 0.00e+00 | 94.5% |
| 452 | KR033045 | Illinoia goldamaryae voucher CNC#HEM057301 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 502.0 | 0.00e+00 | 94.4% |
| 453 | KR036856 | Illinoia goldamaryae voucher CNC#HEM057330 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 99.3% | 502.0 | 0.00e+00 | 94.4% |
| 454 | KR564611 | Illinoia sp. BOLD-2016 voucher BIOUG07601-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 501.0 | 0.00e+00 | 94.4% |
| 455 | MN319916 | Acyrthosiphon malvae voucher NIBGE APH-00279 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 99.2% | 501.0 | 0.00e+00 | 94.4% |
| 456 | KR037710 | Macrosiphum hamiltoni voucher CNC#HEM070721 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 508.0 | 0.00e+00 | 94.3% |
| 457 | KR035505 | Macrosiphum pseudocoryli voucher BIOUG09028-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 504.0 | 0.00e+00 | 94.3% |
| 458 | EU701271 | Acyrthosiphon lactucae voucher CNC#HEM055937 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 459 | KR044087 | Acyrthosiphon churchillense voucher BIOUG02045-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 460 | FJ982383 | Acyrthosiphon kondoi cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 461 | KR034655 | Aulacorthum solani voucher CNC#HEM113997 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 462 | KR035176 | Illinoia crystleae voucher CNC#HEM062514 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 463 | KR034407 | Illinoia goldamaryae voucher BIOUG02022-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 99.8% | 503.0 | 0.00e+00 | 94.3% |
| 464 | KR035161 | Acyrthosiphon churchillense voucher CNC#HEM057413 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 465 | KF639118 | Aulacorthum solani voucher INRA CBGP ACOE1349/chasses1349-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 466 | GU668330 | Illinoia menziesiae voucher CNC#HEM063445 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 467 | HM117764 | Aulacorthum corydalicola voucher 060408SH09 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 468 | MF040668 | Metopolophium dirhodum cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 469 | KR032982 | Acyrthosiphon assiniboinense voucher CNC#HEM057059 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 470 | EU701701 | Illinoia crystleae voucher CNC#HEM026213 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 471 | KR039275 | Illinoia menziesiae voucher 10BBCHEM-0161 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 472 | KC502043 | Acyrthosiphon churchillense voucher CCDB-08110-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 473 | GU668279 | Illinoia crystleae voucher CNC#HEM064066 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 474 | GU978931 | Sitobion avenae isolate 050518S20 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 475 | GU668345 | Acyrthosiphon lactucae voucher CNC#HEM063354 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 476 | GU978860 | Acyrthosiphon kondoi isolate 050513J22 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 597 | 100.0% | 503.0 | 0.00e+00 | 94.3% |
| 477 | KR035083 | Macrosiphum stanleyi voucher CNC#HEM057567 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 502.0 | 0.00e+00 | 94.1% |
| 478 | KR038196 | Sitobion avenae voucher 10BBCHEM-0530 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 502.0 | 0.00e+00 | 94.1% |
| 479 | KR031513 | Aulacorthum solani voucher CNC#HEM054346 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 501.0 | 0.00e+00 | 94.1% |
| 480 | KR031269 | Aulacorthum solani voucher CNC#HEM114034 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 501.0 | 0.00e+00 | 94.1% |
| 481 | KR042019 | Aulacorthum solani voucher CNC#HEM062451 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 501.0 | 0.00e+00 | 94.1% |
| 482 | KR039323 | Aulacorthum solani voucher CNC#HEM061902 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 483 | JF969253 | Aulacorthum solani cytochrome oxidase subunit I gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 484 | MG167366 | Acyrthosiphon sp. BIOUG20982-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 485 | KJ502199 | Aulacorthum solani voucher 031009SH15 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 486 | EU701525 | Aulacorthum solani voucher CNC#HEM055900 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 487 | KY606275 | Aulacorthum solani isolate Modipuram_CA4 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 488 | FJ752009 | Aulacorthum muradachi cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 489 | HQ971325 | Macrosiphum insularis voucher CNC#HEM068422 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 490 | DQ499031 | Brachycaudus persicae cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 491 | KR030584 | Macrosiphum coryli voucher CNC#HEM056841 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 492 | EU701524 | Aulacorthum pterinigrum voucher CNC#HEM054308 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 493 | KR569815 | Macrosiphum sp. BOLD-2016 voucher BIOUG05473-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 494 | GU978906 | Acyrthosiphon chelidonii isolate 070502W011 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 495 | HQ578885 | Aulacorthum solani voucher CNC#HEM049282 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 496 | KY606278 | Aulacorthum solani isolate Jalandhar_A3 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 497 | MK814189 | Aulacorthum solani cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 498 | EU701736 | Macrosiphum sp. A RGF-2008 voucher CNC#HEM113740 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 499 | GU668718 | Amphorophora nr. geranii RFBAE785-09 voucher CNC#HEM063733 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
| 500 | EU189648 | Brachycaudus persicae isolate 1696 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 597 | 100.0% | 500.0 | 0.00e+00 | 94.1% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the identity (%) of BLAST hits grouped by genus. Each data point shows the alignment identity between the query and matched reference sequence. The analyst may wish to use this to make a subjective genus-level identification for the sample.
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity |
|---|---|---|---|---|---|
| Myzus persicae | - | - | - | - | - |
| Aphididae | family | Aphididae | Macrosiphum sp. BOLD-2016 | KR577906 | 0.981 |
See the Database coverage section to see database coverage for taxa of interest.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Preliminary ID
Taxa of interest
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Aphididae at the given locus COI.
Database coverage
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 399 sequences in the reference database for Myzus persicae at the given locus COI.
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Aphididae at the given locus COI.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |